Stem-loop sequence gma-MIR4413a

AccessionMI0016579 (change log)
Previous IDsgma-MIR4413
DescriptionGlycine max miR4413 stem-loop
Literature search

8 open access papers mention gma-MIR4413a
(16 sentences)

Stem-loop
   ucauc                            auua g a   u 
5'      aauaagagaauuguaagucacuguauua    g a cug u
        ||||||||||||||||||||||||||||    | | ||| g
3'      uuauucucuuaacauucagugacauagu    c u gau a
   ---aa                            ---a g a   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr19: 1832822-1832908 [+]
intergenic
Database links

Mature sequence gma-miR4413a

Accession MIMAT0018338
Previous IDsgma-miR4413
Sequence

9 - 

aagagaauuguaagucacug

 - 28

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).
2