![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR156g |
|||||
Accession | MI0016580 (change log) | ||||
Description | Glycine max miR156g stem-loop | ||||
Gene family | MIPF0000008; MIR156 | ||||
Literature search |
![]()
40 open access papers mention gma-MIR156g | ||||
Stem-loop |
ugaacaauaucu ac u -- a c a
5' uga agu uguugacagaagauagagagcacagg ug ucauac caaaa a
||| ||| |||||||||||||||||||||||||| || |||||| |||||
3' acu uca guaacugucuucuaucucucguguuu ac agugug guuuu g
------------ cu u ug g u c
|
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR156g |
|
Accession | MIMAT0018339 |
Sequence |
27 - acagaagauagagagcacag - 46 |
Evidence | experimental; Illumina [1-2] |
References |
|
1 |
PMID:20122185
"Prediction of novel miRNAs and associated target genes in Glycine max"
BMC Bioinformatics. 11 Suppl 1:S14(2010).
|
2 |
PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"
PLoS One. 9:e86153(2014).
|