Stem-loop sequence gma-MIR4416a

AccessionMI0016585 (change log)
Previous IDsgma-MIR4416
DescriptionGlycine max miR4416 stem-loop
Gene family MIPF0001389; MIR4416
Literature search

5 open access papers mention gma-MIR4416a
(11 sentences)

Stem-loop
   ----     au           aa  g         ggauuggguucaguucuggucucacacggu 
5'     cuuug  cugggugagag  ac cguaucgau                              u
       |||||  |||||||||||  || |||||||||                               
3'     gagac  gauccacucuc  ug gcauagcua                              u
   cguu     cg           gc  g         guuuugugucagucauguuuaacaaucuug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr19: 40891340-40891469 [-]
intergenic
Database links

Mature sequence gma-miR4416a

Accession MIMAT0018344
Previous IDsgma-miR4416
Sequence

101 - 

acgggucgcucucaccuagg

 - 120

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).
2