![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-3936 |
|||||
Accession | MI0016592 (change log) | ||||
Symbol | HGNC:MIR3936 | ||||
Description | Homo sapiens miR-3936 stem-loop | ||||
Stem-loop |
--a a uc a --ca g caaau ---- u 5' ug u ag gcaucuguc gugucugcugua aucccu cc gugu u || | || ||||||||| |||||||||||| |||||| || |||| 3' ac g uc cguagacag cguagacgguau ugggga gg cgca g acg - gu a ccca g ---au ucuu g |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-3936 |
|
Accession | MIMAT0018351 |
Sequence |
66 - uaagggguguauggcagaugca - 87 |
Deep sequencing | 196 reads, 48 experiments |
Evidence | experimental; Illumina [1-3] |
Database links |
|
Predicted targets |
|
References |
|
1 | |
2 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|
3 |
PMID:21606961
"Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia"
Leukemia. 25:1389-1399(2011).
|