![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-3942 |
|||||
Accession | MI0016599 (change log) | ||||
Symbol | HGNC:MIR3942 | ||||
Description | Homo sapiens miR-3942 stem-loop | ||||
Literature search |
2 open access papers mention hsa-mir-3942 | ||||
Stem-loop |
ucu ---- c a c c ag cga 5' ucagu augacac ucaaaga g aauacuguua cugaaau gcug a ||||| ||||||| ||||||| | |||||||||| ||||||| |||| g 3' aguca uacugug aguuucu c uuaugacaau gacuuua ugac a --c cuua a a a a -- aau |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-3942-5p |
|
Accession | MIMAT0018358 |
Previous IDs | hsa-miR-3942 |
Sequence |
23 - aagcaauacuguuaccugaaau - 44 |
Deep sequencing | 165 reads, 46 experiments |
Evidence | experimental; Illumina [1-3] |
Predicted targets |
|
Mature sequence hsa-miR-3942-3p |
|
Accession | MIMAT0019230 |
Sequence |
65 - uuucagauaacaguauuacau - 85 |
Deep sequencing | 127 reads, 34 experiments |
Evidence | experimental; Illumina [2-3] |
Predicted targets |
|
References |
|
1 | |
2 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|
3 |
PMID:21606961
"Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia"
Leukemia. 25:1389-1399(2011).
|