![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-3944 |
|||||
Accession | MI0016601 (change log) | ||||
Symbol | HGNC:MIR3944 | ||||
Description | Homo sapiens miR-3944 stem-loop | ||||
Stem-loop |
---uccacccag u u -a ------ c 5' caggcgcaggucc g gcagcaggcca ccgagaa gcg c ||||||||||||| | ||||||||||| ||||||| ||| 3' guccguguccagg c cgucguccggu ggcuuuu ugc u gucguaauucua c u cg acccuc g |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-3944-5p |
|
Accession | MIMAT0019231 |
Sequence |
23 - ugugcagcaggccaaccgaga - 43 |
Deep sequencing | 149 reads, 42 experiments |
Evidence | experimental; Illumina [2] |
Predicted targets |
|
Mature sequence hsa-miR-3944-3p |
|
Accession | MIMAT0018360 |
Previous IDs | hsa-miR-3944 |
Sequence |
63 - uucgggcuggccugcugcuccgg - 85 |
Deep sequencing | 149 reads, 37 experiments |
Evidence | experimental; Illumina [1-2] |
Predicted targets |
|
References |
|
1 | |
2 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|