Stem-loop sequence hsa-mir-3945

Accession

MI0016602 (change log)

Symbol

HGNC:MIR3945

Description

Homo sapiens miR-3945 stem-loop

Literature search

2 open access papers mention hsa-mir-3945
(3 sentences)

Stem-loop

   gau     --ugca g g  -gg             gag     a  uaaa 
5'    guuga      c u ac   ggagggcauagga   gguug ua    a
      |||||      | | ||   |||||||||||||   ||||| ||    u
3'    uaacu      g g ug   ccuuucguauucu   ccgac au    g
   uag     uaguag g g  aaa             ---     -  uaac 

Deep sequencing

45 reads, 0 reads per million, 29 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr4: 184851013-184851110 [-]
• Overlapping transcripts:

  antisense

  OTTHUMT00000361439 ; STOX2-005; intron 1

  OTTHUMT00000361433 ; STOX2-001; intron 1

  ENST00000511250 ; STOX2-005; intron 1

  ENST00000308497 ; STOX2-001; intron 1

  ENST00000438269 ; STOX2-201; intron 1

Database links

• EntrezGene:MIR3945
• HGNC:MIR3945
• miRBase Tracker:MI0016602

Mature sequence hsa-miR-3945

• Accession: MIMAT0018361
• Sequence: 23 - agggcauaggagaggguugauau - 45
• Deep sequencing: 6 reads, 6 experiments
• Evidence: experimental; Illumina [1]
• Predicted targets:
  • TargetMiner:hsa-miR-3945
  • TargetScanVert:hsa-miR-3945
  • miRDB:hsa-miR-3945

References

1. PMID:20498841 "Deep sequencing of human nuclear and cytoplasmic small RNAs reveals an unexpectedly complex subcellular distribution of miRNAs and tRNA 3' trailers" Liao JY, Ma LM, Guo YH, Zhang YC, Zhou H, Shao P, Chen YQ, Qu LH PLoS One. 5:e10563(2010).