Stem-loop sequence far-MIR159

AccessionMI0016603 (change log)
DescriptionFestuca arundinacea miR159 stem-loop
Gene family MIPF0000010; MIR159
Stem-loop
   guuu    uu  g ug        a   u     u  aa    uu  uag      -    a a   g    u     g uc    uau    c    g uug 
5'     gguu  ga g  gagcuccu uca uccaa ga  gguc  gc   gagggg uggu c gcu cucg ucaug u  ccac   ccua cucc u   a
       ||||  || |  |||||||| ||| ||||| ||  ||||  ||   |||||| |||| | ||| |||| ||||| |  ||||   |||| |||| |    
3'     ccgg  cu c  cucgaggg agu agguu cu  ccgg  cg   cucccc gcua g cga gagc aguac a  ggug   ggau gagg a   a
   ---u    uu  a gu        a   u     u  cg    -u  ---      u    c c   g    c     g uc    ucc    a    g cca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence far-miR159

Accession MIMAT0018362
Sequence

169 - 

uuuggauugaagggagcucug

 - 189

Get sequence
Evidence not experimental

References

1