Stem-loop sequence far-MIR171

AccessionMI0016605 (change log)
DescriptionFestuca arundinacea miR171 stem-loop
Gene family MIPF0000030; MIR171_1
   --------------gag                        aca      ug ucucu    a   u  u  c 
5'                  ugcgauguuggcaugguucaauca   aucgag  g     gcau gcu cc ug u
                    ||||||||||||||||||||||||   ||||||  |     |||| ||| || ||  
3'                  acgcuauaaccgugccgaguuagu   uaguuc  u     cgua cgg gg gc a
   cccgauccguccuucga                        --c      gu -ucgu    -   u  u  g 
Get sequence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence far-miR171

Accession MIMAT0018364

90 - 


 - 110

Get sequence
Evidence not experimental
