Stem-loop sequence far-MIR1119

AccessionMI0016606 (change log)
DescriptionFestuca arundinacea miR1119 stem-loop
Gene family MIPF0001156; MIR1119
Stem-loop
   ccagcgagugagcucgcgagcgcggaggagcuggcucagcggcucagcgccucaugcca           gu  c   -  gu 
5'                                                            gccgugccacg  gg agu cg  c
                                                              |||||||||||  || ||| ||   
3'                                                            cggcacggugc  cc uca gu  g
   --------------------uuuucaucgugaggugagacgaccgacugauucguagug           au  -   u  gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence far-miR1119

Accession MIMAT0018365
Sequence

99 - 

uggcacggcgugaugcuuagucag

 - 122

Get sequence
Evidence not experimental

References

1