Stem-loop sequence far-MIR156a

AccessionMI0016609 (change log)
DescriptionFestuca arundinacea miR156a stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
   ------g  g  cgau   cg     g   cc   g    ug uauc        gaguugacagaagagagagagcacagcuggagucgguggcg 
5'        ca ac    ggu  uggcu gca  gug gugg  g    ccauggcu                                         a
          || ||    |||  ||||| |||  ||| ||||  |    ||||||||                                          
3'        gu ug    cca  accgg ugu  cgu uacc  c    ggugccga                                         c
   cgcagga  g  ---c   au     g   -a   a    gu ----        aggggccaggucucgagggagguccgcccacagaguguccc 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence far-miR156a

Accession MIMAT0018368
Sequence

54 - 

ugacagaagagagagagcaca

 - 74

Get sequence
Evidence not experimental

References

1