Stem-loop sequence far-MIR169

AccessionMI0016612 (change log)
DescriptionFestuca arundinacea miR169 stem-loop
Gene family MIPF0000012; MIR169_1
Stem-loop
   ggcacgagggcaaagccuuacauggcugcaagggccuuaccucuga         a     u       --u    -uu     cuca  u  cu 
5'                                               uagccaagg ugacu gccuaug   cuuc   ccucc    ga gc  a
                                                 ||||||||| ||||| |||||||   ||||   |||||    || ||  a
3'                                               aucgguucc acuga cggguac   gggg   ggagg    uu cg  u
   ----------------------------------ucggugaguccg         -     -       ucu    ugu     ----  c  au 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence far-miR169

Accession MIMAT0018371
Sequence

47 - 

uagccaaggaugacuugccua

 - 67

Get sequence
Evidence not experimental

References

1