Stem-loop sequence far-MIR166

AccessionMI0016616 (change log)
DescriptionFestuca arundinacea miR166 stem-loop
Gene family MIPF0000004; MIR166
   uuucggcaacuuuggcaggcuccaugccuacgaggccgcaagcucgcgcagcuauacccgcgcaacc   c   -a   - aau        
5'                                                                    aug gag  ugg c   gauucca 
                                                                      ||| |||  ||| |   |||||| a
3'                                                                    uac uuc  acc g   cuaaggu 
   ---------------------------------------------ccgugcuccgguuuacggaccc   -   gg   a -gc        
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence far-miR166

Accession MIMAT0018375

97 - 


 - 117

Get sequence
Evidence not experimental
