Stem-loop sequence ngi-let-7

AccessionMI0016654 (change log)
DescriptionNasonia giraulti let-7 stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   ----     c     u   g                  ggaaugaaaauu 
5'     cgacg cuggg gag uaguagguuguauagugg            c
       ||||| ||||| ||| ||||||||||||||||||             
3'     gcugu ggccc uuc aucguucaacaugucacc            g
   cgcg     u     u   a                  uaagguauuacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ngi-let-7

Accession MIMAT0018413
Sequence

12 - 

ugagguaguagguuguauagu

 - 32

Get sequence
Evidence not experimental

References

1
"Computational Identification and Characterization of Putative miRNAs in Nasonia Species" Sathyamurthy G, Swamy NR Int J Insect Sci. 2:1-13(2010).