Stem-loop sequence hsa-mir-550b-2

AccessionMI0016687 (change log)
Symbol HGNC:MIR550B2
DescriptionHomo sapiens miR-550b-2 stem-loop
Gene family MIPF0000334; mir-550
Literature search

13 open access papers mention hsa-mir-550b-2
(24 sentences)

Stem-loop 
   ------aga a  c     agau                  cacua    ac 
5'          g cu gcugg    gugccugagggaguaaga     ucug  a
            | || |||||    ||||||||||||||||||     ||||  a
3'          c ga cgacc    cacggacucccucauucu     ggac  c
   acuacgaaa -  c     acgu                  ---cg    aa
Get sequence
Deep sequencing
3279 reads, 2.83 reads per million, 106 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 32732981-32733077 [-]
sense
OTTHUMT00000328640 ; AC018633.4-001; intron 7
ENST00000417811 ; DPY19L1P1-001; intron 7
antisense
ENST00000404479 ; AVL9-201; intron 10
Clustered miRNAs
< 10kb from hsa-mir-550b-2
hsa-mir-550b-2chr7: 32732981-32733077 [-]
hsa-mir-550a-2chr7: 32732981-32733077 [+]
Database links

Mature sequence hsa-miR-550b-2-5p

Accession MIMAT0022737
Sequence

16 -  

augugccugagggaguaagaca

 - 37

Get sequence
Deep sequencing5751 reads, 89 experiments
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-550b-3p

Accession MIMAT0018445
Previous IDshsa-miR-550b
Sequence

58 -  

ucuuacucccucaggcacug

 - 77

Get sequence
Deep sequencing792 reads, 49 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).