Stem-loop sequence hsa-mir-548z

Accession MI0016688
Description Homo sapiens miR-548z stem-loop
Gene family MIPF0000317; mir-548
Stem-loop 
-------aag     a                   a a         c  a 
          uauua guuggugcaaaaguaauug g uuuuugcua ug a
          ||||| ||||||||||||||||||| | ||||||||| ||  
          auaau caaccacguuuucauuaac c aaaaacggu au a
guaaccguag     c                   g c         a  g
Get sequence
Deep sequencing
64 reads, 22 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr12: 65016289-65016385 [-]
antisense
OTTHUMT00000401160 ; RASSF3-002; intron 1
OTTHUMT00000401161 ; RASSF3-001; intron 1
OTTHUMT00000401160 ; RASSF3-002; intron 1
OTTHUMT00000401161 ; RASSF3-001; intron 1
OTTHUMT00000401160 ; RASSF3-002; intron 1
OTTHUMT00000401161 ; RASSF3-001; intron 1
ENST00000283172 ; RASSF3-002; intron 1
ENST00000542104 ; RASSF3-001; intron 1
ENST00000541539 ; RASSF3-202; intron 1
ENST00000283172 ; RASSF3-002; intron 1
ENST00000542104 ; RASSF3-001; intron 1
ENST00000541539 ; RASSF3-202; intron 1
ENST00000283172 ; RASSF3-002; intron 1
ENST00000542104 ; RASSF3-001; intron 1
ENST00000336061 ; RASSF3-201; intron 2
ENST00000336061 ; RASSF3-201; intron 2
ENST00000336061 ; RASSF3-201; intron 2
Clustered miRNAs
< 10kb from hsa-mir-548z
hsa-mir-548c chr12: 65016289-65016385 [+]
hsa-mir-548z chr12: 65016289-65016385 [-]
Database links

Mature sequence hsa-miR-548z

Accession MIMAT0018446
Sequence

54 -  

caaaaaccgcaauuacuuuugca

 - 76

Get sequence
Deep sequencing 60 reads, 20 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).