Stem-loop sequence hsa-mir-548aa-2

Accession

MI0016690 (change log)

Symbol

HGNC:MIR548AA2

Description

Homo sapiens miR-548aa-2 stem-loop

Gene family

MIPF0000317; mir-548

Literature search

56 open access papers mention hsa-mir-548aa-2
(170 sentences)

Stem-loop

   -------uuuua                 a  c                ac 
5'             uuagguuggugcaaaag aa ugugguuuuugccauu  u
               ||||||||||||||||| || ||||||||||||||||   
3'             aauccaaccacguuuuc uu acaccaaaaacgguaa  u
   cucucccuucua                 a  a                cu 

Deep sequencing

4334 reads, 1.43 reads per million, 140 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr17: 67471489-67471585 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000450689 ; MAP2K6-001; intron 1

  OTTHUMT00000450690 ; MAP2K6-003; intron 1

  OTTHUMT00000450691 ; MAP2K6-005; intron 1

  ENST00000590474 ; MAP2K6-001; intron 1

  ENST00000586641 ; MAP2K6-003; intron 1

  ENST00000359094 ; MAP2K6-005; intron 1

Clustered miRNAs

< 10kb from hsa-mir-548aa-2

• hsa-mir-548aa-2: chr17: 67471489-67471585 [+]
• hsa-mir-548d-2: chr17: 67471489-67471585 [-]

Database links

• EntrezGene:MIR548AA2
• HGNC:MIR548AA2
• RNAcentral:URS0000759B83_9606
• miRBase Tracker:MI0016690

Mature sequence hsa-miR-548aa

• Accession: MIMAT0018447
• Sequence: 55 - aaaaaccacaauuacuuuugcacca - 79
• Deep sequencing: 8078 reads, 140 experiments
• Evidence: experimental; Illumina [1]
• Database links:
  • RNAcentral:URS000012930C_9606
• Predicted targets:
  • TargetMiner:hsa-miR-548aa
  • TargetScanVert:hsa-miR-548aa
  • miRDB:hsa-miR-548aa

References

1. PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).