Dead miRNA entry

miRNA accession:
MI0016747
miRNA ID:
hsa-mir-1254-2
Comment:
The sequence annotated as miR-1254 maps many times to primate genomes, and the pattern of reads from deep sequencing datasets in human does not support the miRNA annotation. The sequence is therefore removed from the database.

Previous miRNA entry

Stem-loop sequence hsa-mir-1254-2

AccessionMI0016747 (change log)
Symbol HGNC:MIR1254-2
DescriptionHomo sapiens miR-1254-2 stem-loop
Gene family MIPF0000614; mir-1254
Stem-loop
   cuga   ug aa       cc     u ag uau 
5'     gcc  g  gcuggag  ugcag g  c   g
       |||  |  |||||||  ||||| |  |   a
3'     cgg  c  cgaucuc  auguc c  g   u
   ---a   gu --       --     - cu uac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hsa-miR-1254

Accession MIMAT0005905
Sequence

4 - 

agccuggaagcuggagccugcagu

 - 27

Get sequence
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).