![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-1268b |
|||||
Accession | MI0016748 (change log) | ||||
Symbol | HGNC:MIR1268B | ||||
Description | Homo sapiens miR-1268b stem-loop | ||||
Literature search |
![]()
17 open access papers mention hsa-mir-1268b | ||||
Stem-loop |
a --- g ugg g g 5' cccg ggc ugg ug gggu g |||| ||| ||| || |||| 3' gggu ucg acc au uccg g a uga - uua g u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-1268b |
|
Accession | MIMAT0018925 |
Sequence |
4 - cgggcgugguggugggggug - 23 |
Deep sequencing | 5405 reads, 155 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|