miRBase entry: hsa-mir-4423

Stem-loop hsa-mir-4423


Accession
MI0016760
Symbol
HGNC: MIR4423
Description
Homo sapiens hsa-mir-4423 precursor miRNA
Gene family
MIPF0001587; mir-4423

Literature search
5 open access papers mention hsa-mir-4423
(19 sentences)

Sequence

742 reads, 246 reads per million, 57 experiments
aucauguacugcAGUUGCCUUUUUGUUCCCAUGCuguuuaagccuagcAUAGGCACCAAAAAGCAACAAcaguaugugaa
.((((((((((..(((((.((((((...((((((((........)))))).))...)))))))))))..)))))))))).

Structure
a          cA     C      UUC  -      uuu 
 ucauguacug  GUUGC UUUUUG   CC AUGCug   a
 ||||||||||  ||||| ||||||   || ||||||    
 aguguaugac  CAACG AAAAAC   GG UAcgau   a
a          AA     -      CAC  A      ccg 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr1: 85133794-85133873 [+]

Disease association
hsa-mir-4423 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-4423-5p

Accession MIMAT0019232
Description Homo sapiens hsa-miR-4423-5p mature miRNA
Sequence 13 - AGUUGCCUUUUUGUUCCCAUGC - 34
Evidence experimental
Illumina [2,4]
Database links
Predicted targets

Mature hsa-miR-4423-3p

Accession MIMAT0018936
Description Homo sapiens hsa-miR-4423-3p mature miRNA
Sequence 49 - AUAGGCACCAAAAAGCAACAA - 69
Evidence experimental
Illumina [1-2,4]
Database links
Predicted targets

References

  1. PubMed ID: 20733160
    Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs
    "Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI,"
    "Blood (2010) 116:e118-e127

  2. PubMed ID: 21199797
    Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene
    "Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C"
    "Cancer Res (2011) 71:78-86

  3. PubMed ID: 21911355
    miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades
    "Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N"
    "Nucleic Acids Res (2012) 40:37-52

  4. PubMed ID: 21807764
    Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome
    "Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM"
    "Hum Mol Genet (2011) 20:4025-4040

  5. PubMed ID: 24158479
    MicroRNA 4423 is a primate-specific regulator of airway epithelial cell differentiation and lung carcinogenesis
    "Perdomo C, Campbell JD, Gerrein J, Tellez CS, Garrison CB, Walser TC, Drizik E, Si H, Gower AC, Vick J, Anderlind C, Jackson GR, Mankus C, Schembri F, O'Hara C, Gomperts BN, Dubinett SM, Hayden P, Belinsky SA, Lenburg ME, Spira A"
    "Proc Natl Acad Sci U S A (2013) 110:18946-18951