Stem-loop sequence hsa-mir-378g

Accession

MI0016761

Description

Homo sapiens miR-378g stem-loop

Stem-loop

-ca       u        a 
   cugggcu ggagucag a
   ||||||| |||||||| g
   gacccga ccucgguc a
cuc       -        c 

Deep sequencing

305543 reads, 29 experiments

Genome context

• Coordinates (GRCh37.p5): chr1: 95211416-95211456 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000029548 ; RP11-86H7.1-001; intron 1

  OTTHUMT00000029549 ; RP11-86H7.1-002; intron 1

  OTTHUMT00000029550 ; RP11-86H7.1-003; intron 1

  OTTHUMT00000029551 ; RP11-86H7.1-004; intron 1

  OTTHUMT00000029552 ; RP11-86H7.1-005; intron 1

  OTTHUMT00000029548 ; RP11-86H7.1-001; intron 1

  OTTHUMT00000029549 ; RP11-86H7.1-002; intron 1

  OTTHUMT00000029550 ; RP11-86H7.1-003; intron 1

  OTTHUMT00000029551 ; RP11-86H7.1-004; intron 1

  OTTHUMT00000029552 ; RP11-86H7.1-005; intron 1

  OTTHUMT00000029548 ; RP11-86H7.1-001; intron 1

  OTTHUMT00000029549 ; RP11-86H7.1-002; intron 1

  OTTHUMT00000029550 ; RP11-86H7.1-003; intron 1

  OTTHUMT00000029551 ; RP11-86H7.1-004; intron 1

  OTTHUMT00000029552 ; RP11-86H7.1-005; intron 1

  ENST00000452922 ; RP11-86H7.1-001; intron 1

  ENST00000418366 ; RP11-86H7.1-002; intron 1

  ENST00000421997 ; RP11-86H7.1-003; intron 1

  ENST00000414374 ; RP11-86H7.1-004; intron 1

  ENST00000442418 ; RP11-86H7.1-005; intron 1

  ENST00000452922 ; RP11-86H7.1-001; intron 1

  ENST00000418366 ; RP11-86H7.1-002; intron 1

  ENST00000421997 ; RP11-86H7.1-003; intron 1

  ENST00000414374 ; RP11-86H7.1-004; intron 1

  ENST00000442418 ; RP11-86H7.1-005; intron 1

  ENST00000452922 ; RP11-86H7.1-001; intron 1

  ENST00000418366 ; RP11-86H7.1-002; intron 1

  ENST00000421997 ; RP11-86H7.1-003; intron 1

  ENST00000414374 ; RP11-86H7.1-004; intron 1

  ENST00000442418 ; RP11-86H7.1-005; intron 1

Database links

• ENTREZGENE: 100616321;MIR378G

Mature sequence hsa-miR-378g

• Accession: MIMAT0018937
• Sequence: 2 - acugggcuuggagucagaag - 21
• Deep sequencing: 305543 reads, 29 experiments
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-378g
  • MIRDB:hsa-miR-378g
  • TARGETMINER:hsa-miR-378g

References

1. PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).