miRBase entry: hsa-mir-548ac

Stem-loop hsa-mir-548ac


Accession
MI0016762
Symbol
HGNC: MIR548AC
Description
Homo sapiens hsa-mir-548ac precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR548AC is a microRNA located within the first intron of the CD58 gene, which has been implicated in immunological conditions, although research on its specific role is limited [PMC10061723]. The International Multiple Sclerosis Genetics Consortium (IMSGC) identified a single nucleotide polymorphism (SNP), rs1414273, within MIR548AC that may influence multiple sclerosis (MS) susceptibility due to its decoupling effect on the transcription of CD58 and MIR548AC [PMC10061723]. This SNP is also associated with changes in the stability of MIR548AC [PMC10061723]. Despite identifying six candidate MS-associated miR-SNPs, including rs1414273 in MIR548AC, further prioritization was not pursued for five of them due to either a lack of predicted structural changes or high linkage disequilibrium in the major histocompatibility complex (MHC) locus [PMC10061723'>PMC10061723]. However, rs1414273 was prioritized based on structural and functional predictions that suggest the risk allele may lead to increased levels of MIR548AC [PMC10061723]. The prioritization process underscored rs1414273 as a notable candidate SNP for MS among other potential candidates identified by IMSGC [PMC10061723].

Literature search
56 open access papers mention hsa-mir-548ac
(170 sentences)

Sequence

221 reads, 2 reads per million, 38 experiments
guauuagguuggugcaaaaguuauugugguuuuugcuauuuuuuuuuaauggCAAAAACCGGCAAUUACUUUUGcacuaaccuaguag
.((((((((((((((((((((.((((((((((((((((((.......))))))))))))).))))).)))))))))))))))))))).

Structure
g                    u     -             uu 
 uauuagguuggugcaaaagu auugu gguuuuugcuauu  u
 |||||||||||||||||||| ||||| |||||||||||||  u
 augauccaaucacGUUUUCA UAACG CCAAAAACgguaa  u
g                    U     G             uu 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr1: 116560024-116560111 [-]

Disease association
hsa-mir-548ac is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-548ac

Accession MIMAT0018938
Description Homo sapiens hsa-miR-548ac mature miRNA
Sequence 53 - CAAAAACCGGCAAUUACUUUUG - 74
Evidence experimental
Illumina [1]
Database links
Predicted targets

References

  1. PubMed ID: 20733160
    Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs
    "Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI,"
    "Blood (2010) 116:e118-e127