![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4427 |
|||||
Accession | MI0016766 (change log) | ||||
Symbol | HGNC:MIR4427 | ||||
Description | Homo sapiens miR-4427 stem-loop | ||||
Gene family | MIPF0001640; mir-4427 | ||||
Stem-loop |
c g - -- 5' gaag cucuu gggcuu auuuagac aaugguu |||| ||||| |||||| |||||||| |||||| u 3' uuuc gagaa ucugag uaagucug uuacuac u g a cu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-4427 |
|
Accession | MIMAT0018942 |
Sequence |
44 - ucugaauagagucugaagagu - 64 |
Deep sequencing | 6 reads, 5 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|