![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-548ad |
|||||
Accession | MI0016770 (change log) | ||||
Symbol | HGNC:MIR548AD | ||||
Description | Homo sapiens miR-548ad stem-loop | ||||
Gene family | MIPF0000317; mir-548 | ||||
Literature search |
![]()
56 open access papers mention hsa-mir-548ad | ||||
Stem-loop |
c a g -a 5' uguuagguuggugcaaaagu auugu guuuuug aagu |||||||||||||||||||| ||||| ||||||| ||| a 3' auaaucuaaccacguuuuca uaaca caaaagc uuca c g g gg |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-548ad-5p |
|
Accession | MIMAT0032114 |
Sequence |
16 - aaaaguaauugugguuuuug - 35 |
Deep sequencing | 10791 reads, 154 experiments |
Evidence | not experimental |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-548ad-3p |
|
Accession | MIMAT0018946 |
Previous IDs | hsa-miR-548ad |
Sequence |
49 - gaaaacgacaaugacuuuugca - 70 |
Deep sequencing | 131 reads, 42 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|
2 |
PMID:21558790
"Enhancing miRNA annotation confidence in miRBase by continuous cross dataset analysis"
RNA Biol. 8:378-383(2011).
|