Stem-loop sequence hsa-mir-4436a

AccessionMI0016776 (change log)
Symbol HGNC:MIR4436A
DescriptionHomo sapiens miR-4436a stem-loop
Gene family MIPF0001236; mir-4436
Literature search

1 open access papers mention hsa-mir-4436a
(1 sentences)

Stem-loop 
   g        u       a      c       cuc     ugc 
5'  ccucacuu uccacuu ugccug ccugccc   gaauc   u
    |||||||| ||||||| |||||| |||||||   |||||    
3'  ggagugaa aggugaa acggac ggacggg   uuuag   c
   a        u       g      a       ---     cac
Get sequence
Deep sequencing
89 reads, 0 reads per million, 20 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 88812370-88812454 [+]
intergenic
Database links

Mature sequence hsa-miR-4436a

Accession MIMAT0018952
Sequence

56 -  

gcaggacaggcagaaguggau

 - 76

Get sequence
Deep sequencing76 reads, 13 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).