![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4436a |
|||||
Accession | MI0016776 (change log) | ||||
Symbol | HGNC:MIR4436A | ||||
Description | Homo sapiens miR-4436a stem-loop | ||||
Gene family | MIPF0001236; mir-4436 | ||||
Literature search |
1 open access papers mention hsa-mir-4436a | ||||
Stem-loop |
g u a c cuc ugc 5' ccucacuu uccacuu ugccug ccugccc gaauc u |||||||| ||||||| |||||| ||||||| ||||| 3' ggagugaa aggugaa acggac ggacggg uuuag c a u g a --- cac |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-4436a |
|
Accession | MIMAT0018952 |
Sequence |
56 - gcaggacaggcagaaguggau - 76 |
Deep sequencing | 76 reads, 13 experiments |
Evidence | experimental; Illumina [1-2] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|
2 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|