![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4446 |
|||||
Accession | MI0016789 (change log) | ||||
Symbol | HGNC:MIR4446 | ||||
Description | Homo sapiens miR-4446 stem-loop | ||||
Gene family | MIPF0001385; mir-4446 | ||||
Literature search |
2 open access papers mention hsa-mir-4446 | ||||
Stem-loop |
c gu u c uuc cuuca 5' ug ccau uc cugcca ccuugg a || |||| || |||||| |||||| u 3' ac ggua ag gacggu gggacc u a ug c u --c cucau |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-4446-5p |
|
Accession | MIMAT0019233 |
Sequence |
8 - auuucccugccauucccuuggc - 29 |
Deep sequencing | 22 reads, 17 experiments |
Evidence | experimental; Illumina [2-3] |
Predicted targets |
|
Mature sequence hsa-miR-4446-3p |
|
Accession | MIMAT0018965 |
Sequence |
43 - cagggcuggcagugacaugggu - 64 |
Deep sequencing | 1728 reads, 67 experiments |
Evidence | experimental; Illumina [1-3] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|
2 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|
3 |
PMID:22454130
"Transcription factors are targeted by differentially expressed miRNAs in primates"
Genome Biol Evol. 4:552-564(2012).
|