![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4448 |
|||||
Accession | MI0016791 (change log) | ||||
Symbol | HGNC:MIR4448 | ||||
Description | Homo sapiens miR-4448 stem-loop | ||||
Literature search |
![]()
3 open access papers mention hsa-mir-4448 | ||||
Stem-loop |
a agug aaa aa ugc auuau a 5' gg acc agac gag gagccuucu gccc g || ||| |||| ||| ||||||||| |||| a 3' cc ugg ucug uuc cucgggaga cggg c a guaa gga -g --- -ccac a |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-4448 |
|
Accession | MIMAT0018967 |
Sequence |
61 - ggcuccuuggucuaggggua - 80 |
Deep sequencing | 30809 reads, 127 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|