![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4450 |
||||||
Accession | MI0016795 (change log) | |||||
Symbol | HGNC:MIR4450 | |||||
Description | Homo sapiens miR-4450 stem-loop | |||||
Literature search |
2 open access papers mention hsa-mir-4450 | |||||
Stem-loop |
u u uu a ag ag cag 5' guc ggggau gg ga uggug cg g ||| |||||| || || ||||| || 3' cgg ucccug cc cu accac gu u u u gu c cu -g uuc |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence hsa-miR-4450 |
|
Accession | MIMAT0018971 |
Sequence |
5 - uggggauuuggagaagugguga - 26 |
Deep sequencing | 56 reads, 15 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|