![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4457 |
|||||
Accession | MI0016803 (change log) | ||||
Symbol | HGNC:MIR4457 | ||||
Description | Homo sapiens miR-4457 stem-loop | ||||
Stem-loop |
g u g a a 5' gaguac ccagucaauacc ugugaguu ga a |||||| |||||||||||| |||||||| || a 3' cuuaug ggucaguuaugg acacuuaa cu g a c a - c |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-4457 |
|
Accession | MIMAT0018979 |
Sequence |
43 - ucacaagguauugacuggcgua - 64 |
Deep sequencing | 53 reads, 20 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|