![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-3135b |
|||||
Accession | MI0016809 (change log) | ||||
Symbol | HGNC:MIR3135B | ||||
Description | Homo sapiens miR-3135b stem-loop | ||||
Gene family | MIPF0001219; mir-3135 | ||||
Literature search |
1 open access papers mention hsa-mir-3135b | ||||
Stem-loop |
u cu ag -- u - uc 5' gcccagg gg cgag ugcagugg gc ag a ||||||| || |||| |||||||| || || 3' cgggucc uc gcuc acgucacu cg uc g u -- aa cg - a cu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-3135b |
|
Accession | MIMAT0018985 |
Sequence |
7 - ggcuggagcgagugcaguggug - 28 |
Deep sequencing | 196 reads, 47 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|