![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4462 |
|||||
Accession | MI0016810 (change log) | ||||
Symbol | HGNC:MIR4462 | ||||
Description | Homo sapiens miR-4462 stem-loop | ||||
Stem-loop |
c - ug --aa u 5' uuccca gc cccu gucaggag g |||||| || |||| |||||||| g 3' aagggu cg ggga caguccuu c a u gu ggca u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-4462 |
|
Accession | MIMAT0018986 |
Sequence |
35 - ugacacggaggguggcuugggaa - 57 |
Deep sequencing | 2 reads, 2 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|