Stem-loop sequence hsa-mir-4467

AccessionMI0016818 (change log)
Symbol HGNC:MIR4467
DescriptionHomo sapiens miR-4467 stem-loop
Literature search

2 open access papers mention hsa-mir-4467
(4 sentences)

Stem-loop 
   -u  u         agu  u     u  cuuu 
5'   gg ggcggcggu   ua gggcu cu    c
     || |||||||||   || ||||| ||     
3'   cc ccgccgccg   gu cccga ga    u
   uc  u         --g  c     c  ccac
Get sequence
Deep sequencing
431 reads, 0 reads per million, 57 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 102471469-102471531 [+]
antisense
OTTHUMT00000348007 ; FBXL13-007; intron 11
OTTHUMT00000348003 ; FBXL13-003; intron 17
OTTHUMT00000348005 ; FBXL13-005; intron 17
OTTHUMT00000348002 ; FBXL13-002; intron 18
OTTHUMT00000348006 ; FBXL13-006; intron 18
OTTHUMT00000348001 ; FBXL13-001; intron 18
ENST00000456695 ; FBXL13-007; intron 11
ENST00000379306 ; FBXL13-201; intron 11
ENST00000379305 ; FBXL13-003; intron 17
ENST00000455112 ; FBXL13-005; intron 17
ENST00000393772 ; FBXL13-203; intron 17
ENST00000379308 ; FBXL13-202; intron 17
ENST00000448002 ; FBXL13-002; intron 18
ENST00000436908 ; FBXL13-006; intron 18
ENST00000313221 ; FBXL13-001; intron 18
Clustered miRNAs
< 10kb from hsa-mir-4467
hsa-mir-5090chr7: 102465742-102465826 [+]
hsa-mir-4467chr7: 102471469-102471531 [+]
Database links

Mature sequence hsa-miR-4467

Accession MIMAT0018994
Sequence

4 -  

uggcggcgguaguuaugggcuu

 - 25

Get sequence
Deep sequencing352 reads, 29 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).