![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4467 |
||||||
Accession | MI0016818 (change log) | |||||
Symbol | HGNC:MIR4467 | |||||
Description | Homo sapiens miR-4467 stem-loop | |||||
Literature search |
2 open access papers mention hsa-mir-4467 | |||||
Stem-loop |
-u u agu u u cuuu 5' gg ggcggcggu ua gggcu cu c || ||||||||| || ||||| || 3' cc ccgccgccg gu cccga ga u uc u --g c c ccac |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
Mature sequence hsa-miR-4467 |
|
Accession | MIMAT0018994 |
Sequence |
4 - uggcggcgguaguuaugggcuu - 25 |
Deep sequencing | 352 reads, 29 experiments |
Evidence | experimental; Illumina [1-2] |
Predicted targets |
|
References |
|
1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|
2 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|