Stem-loop sequence hsa-mir-4469

AccessionMI0016820 (change log)
Symbol HGNC:MIR4469
DescriptionHomo sapiens miR-4469 stem-loop
Literature search

1 open access papers mention hsa-mir-4469
(1 sentences)

Stem-loop 
   ccg    gga             u   uuu        c a 
5'    acgc   gagcggcucuagg ggg   ggcggcgg g g
      ||||   ||||||||||||| |||   |||||||| |  
3'    ugcg   cucgcugggaucu ccc   ucgccgcc c g
   -ag    agg             -   ---        a a
Get sequence
Deep sequencing
83 reads, 0 reads per million, 38 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 42896197-42896275 [-]
antisense
OTTHUMT00000383238 ; RP11-598P20.5-001; intron 1
OTTHUMT00000383239 ; FNTA-014; intron 1
ENST00000534420 ; RP11-598P20.5-001; intron 1
ENST00000533559 ; FNTA-014; intron 1
Database links

Mature sequence hsa-miR-4469

Accession MIMAT0018996
Sequence

52 -  

gcucccucuagggucgcucgga

 - 73

Get sequence
Deep sequencing69 reads, 30 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).