![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4474 |
|||||
Accession | MI0016826 (change log) | ||||
Symbol | HGNC:MIR4474 | ||||
Description | Homo sapiens miR-4474 stem-loop | ||||
Literature search |
1 open access papers mention hsa-mir-4474 | ||||
Stem-loop |
u a uau 5' ugccuaccuuguuagucucaugaucag cacaaa g ||||||||||||||||||||||||||| |||||| 3' acggauggaacaaucggaguacugguc guguuu g c g cuc |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-4474-5p |
|
Accession | MIMAT0019234 |
Sequence |
13 - uuagucucaugaucagacaca - 33 |
Deep sequencing | 15 reads, 8 experiments |
Evidence | experimental; Illumina [2-3] |
Predicted targets |
|
Mature sequence hsa-miR-4474-3p |
|
Accession | MIMAT0019001 |
Sequence |
45 - uuguggcuggucaugaggcuaa - 66 |
Deep sequencing | 80 reads, 27 experiments |
Evidence | experimental; Illumina [1-3] |
Predicted targets |
|
References |
|
1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|
2 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|
3 |
PMID:21606961
"Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia"
Leukemia. 25:1389-1399(2011).
|