miRBase entry: hsa-mir-4477a

Stem-loop hsa-mir-4477a


Accession
MI0016829
Symbol
HGNC: MIR4477A
Description
Homo sapiens hsa-mir-4477a precursor miRNA

Literature search
2 open access papers mention hsa-mir-4477a
(4 sentences)

Sequence

72 reads, 1 reads per million, 23 experiments
uccuccucccaucaaucacaaauguccuuaauggcauuuaaggauugCUAUUAAGGACAUUUGUGAUUCacgggaggaggu
.(((((((((...(((((((((((((((((((((((.........)))))))))))))))))))))))...))))))))).

Structure
u         auc                       uuu 
 ccuccuccc   aaucacaaauguccuuaauggca   a
 |||||||||   |||||||||||||||||||||||   a
 ggaggaggg   UUAGUGUUUACAGGAAUUAUCgu   g
u         caC                       uag 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr9: 41233755-41233835 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-4477a
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-4477a is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-4477a

Accession MIMAT0019004
Description Homo sapiens hsa-miR-4477a mature miRNA
Sequence 48 - CUAUUAAGGACAUUUGUGAUUC - 69
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 20733160
    Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs
    "Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI,"
    "Blood (2010) 116:e118-e127