![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4477a |
||||||||||
Accession | MI0016829 (change log) | |||||||||
Symbol | HGNC:MIR4477A | |||||||||
Description | Homo sapiens miR-4477a stem-loop | |||||||||
Gene family | MIPF0001274; mir-4477 | |||||||||
Literature search |
2 open access papers mention hsa-mir-4477a | |||||||||
Stem-loop |
u auc uuu 5' ccuccuccc aaucacaaauguccuuaauggca a ||||||||| ||||||||||||||||||||||| a 3' ggaggaggg uuaguguuuacaggaauuaucgu g u cac uag |
|||||||||
Deep sequencing |
| |||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||
Genome context |
|
|||||||||
Clustered miRNAs |
|
|||||||||
Database links |
Mature sequence hsa-miR-4477a |
|
Accession | MIMAT0019004 |
Sequence |
48 - cuauuaaggacauuugugauuc - 69 |
Deep sequencing | 116 reads, 42 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|