|
miRBase |
|
Stem-loop sequence hsa-mir-3689c |
|||||
| Accession | MI0016832 | ||||
| Description | Homo sapiens miR-3689c stem-loop | ||||
| Gene family | MIPF0001144; mir-3689 | ||||
| Stem-loop |
g ug gu g ug g gu a gggag ug auauc g uucc ggag u g u ||||| || ||||| | |||| |||| | | uccuu gu uauag u gagg ccuu g c a g gu ug g gu g ug u |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links |
|
||||
Mature sequence hsa-miR-3689c |
|
| Accession | MIMAT0019007 |
| Sequence |
47 - cugggaggugugauauuguggu - 68 |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|