Stem-loop sequence hsa-mir-3689d-2

AccessionMI0016835 (change log)
Symbol HGNC:MIR3689D2
DescriptionHomo sapiens miR-3689d-2 stem-loop
Gene family MIPF0001144; mir-3689
Stem-loop
   --acu      ---u u    u   a   g u      -  ug 
5'      gggagg    g gauc cac cuc c gggagg ug  c
        ||||||    | |||| ||| ||| | |||||| ||   
3'      uccuuc    c cuag gug gag g cccuuc gc  u
   gcgag      uugu -    u   -   g u      u  ua 
Get sequence
Deep sequencing
20 reads, 0 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 134850277-134850356 [-]
sense
OTTHUMT00000054771 ; MED27-002; intron 3
OTTHUMT00000054770 ; MED27-001; intron 3
ENST00000357028 ; MED27-002; intron 3
ENST00000292035 ; MED27-001; intron 3
Clustered miRNAs
< 10kb from hsa-mir-3689d-2
hsa-mir-3689fchr9: 134850742-134850807 [-]
hsa-mir-3689echr9: 134850570-134850641 [-]
hsa-mir-3689d-2chr9: 134850277-134850356 [-]
hsa-mir-3689bchr9: 134850125-134850272 [-]
hsa-mir-3689d-1chr9: 134849609-134849682 [-]
hsa-mir-3689achr9: 134849487-134849564 [-]
hsa-mir-3689cchr9: 134849298-134849369 [-]
Database links

Mature sequence hsa-miR-3689d

Accession MIMAT0019008
Sequence

4 - 

gggaggugugaucucacacucg

 - 25

Get sequence
Deep sequencing5 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).