MIR4484 is an RNA gene located at chromosome 10 in locus q26.2. It has been shown to act as a tumor suppressor [PMC6776520]. Copy number analysis of the MIR4484 locus was performed using SYBR green-based quantitative PCR with DNA-specific primers [PMC5537698]. The genomic levels of the region encompassing the MIR4484 precursor sequence were assayed, and it was found that the MIR4484 locus undergoes copy number loss [PMC5537698]. The C t values of MIR4484 were normalized with the C t value of GAPDH to obtain ΔC t, and the final copy number was deduced using the ΔΔC t method [PMC5537698]. The deletion at the UROS locus, which is closely located to MIR4484, affected both UROS and MIR4484 genes but did not affect nearby genes such as BRCA2 and CDKN1A interacting protein (BCCIP) and matrix metallopeptidase 21 (MMP21) [PMC5537698]. The correlation between deletion patterns in UROS and MIR4484 was observed through DNA qPCR analysis in a similar set of samples [PMC5537698]. It is worth noting that metalloproteinases, such as matrix metalloproteinase 21 (MMP-21), which is closely located to MIR4484, are known to be involved in fibrotic processes in systemic sclerosis (SSc) [PMC6776520].
-- c --- -a a ggguuuc ucugccuuuuuuucc aaug aaauaacg a ||||||| ||||||||||||||| |||| |||||||| a CCCGAAG GGGCGGAAAAagggg uuac uuuauugu c AC A gag cc c
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0019018 |
Description | Homo sapiens hsa-miR-4484 mature miRNA |
Sequence | 64 - AAAAGGCGGGAGAAGCCCCA - 83 |
Evidence |
experimental
Illumina [1] |
Database links | |
Predicted targets |
|