![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4484 |
|||||
Accession | MI0016845 (change log) | ||||
Symbol | HGNC:MIR4484 | ||||
Description | Homo sapiens miR-4484 stem-loop | ||||
Gene family | MIPF0001440; mir-4484 | ||||
Literature search |
![]()
8 open access papers mention hsa-mir-4484 | ||||
Stem-loop |
-- cu uu --- -a a 5' ggguuuc cugccuuuuu cc aaug aaauaacg a ||||||| |||||||||| || |||| |||||||| a 3' cccgaag ggcggaaaaa gg uuac uuuauugu c ac ag gg gag cc c |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-4484 |
|
Accession | MIMAT0019018 |
Sequence |
64 - aaaaggcgggagaagcccca - 83 |
Deep sequencing | 3887 reads, 132 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|