miRBase entry: hsa-mir-4485

Stem-loop hsa-mir-4485


Accession
MI0016846
Symbol
HGNC: MIR4485
Description
Homo sapiens hsa-mir-4485 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR4485 is a microRNA (miRNA) that has been identified as one of the miRNAs whose maturation can be facilitated by the DGCR8 processing pathway, as marked by METTL3, an enzyme known to be involved in miRNA processing [PMC8426370]. This miRNA is also noted to be highly expressed in certain gene expression profiles, indicating its potential significance in cellular functions [PMC4942618]. Research has shown that METTL3 can enhance the maturation of several miRNAs, including MIR4485, suggesting a regulatory role of METTL3 in MIR4485 biogenesis [PMC6588935]. In studies involving T24 cells, a bladder cancer cell line, alterations in MIR4485 levels were observed following the knockdown of METTL3 [PMC6588935], indicating that MIR4485 expression is at least partly dependent on METTL3 activity. Furthermore, MIR4485 has been listed among the main miRNAs modulated by METTL3 [PMC6588935], reinforcing its potential importance in cellular processes regulated by this enzyme. Validation experiments confirmed that MIR4485 is significantly affected by changes in METTL3 levels within T24 cells [PMC6588935], suggesting a functional relationship between this microRNA and the m6A modification pathway mediated by METTL3.

Literature search
6 open access papers mention hsa-mir-4485
(13 sentences)

Sequence

3201 reads, 50 reads per million, 93 experiments
agaggcACCGCCUGCCCAGUGAcaugcguuUAACGGCCGCGGUACCCUAAcugugca
((.((.(((((..(((....(((....)))....))).))))).)))).........

Structure
---------  a  c     CU   CAGU   a 
         ag gg ACCGC  GCC    GAc u
         || || |||||  |||    |||  
         UC CC UGGCG  CGG    uug g
acgugucAA  -  A     -C   CAAU   c 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr11: 10508270-10508326 [-]

Disease association
hsa-mir-4485 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-4485-3p

Accession MIMAT0019019
Description Homo sapiens hsa-miR-4485-3p mature miRNA
Sequence 31 - UAACGGCCGCGGUACCCUAA - 50
Evidence experimental
Illumina [1]
Database links
Predicted targets

Mature hsa-miR-4485-5p

Accession MIMAT0032116
Description Homo sapiens hsa-miR-4485-5p mature miRNA
Sequence 7 - ACCGCCUGCCCAGUGA - 22
Evidence not_experimental
Database links
Predicted targets

References

  1. PubMed ID: 20733160
    Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs
    "Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI,"
    "Blood (2010) 116:e118-e127