Stem-loop sequence hsa-mir-4489

AccessionMI0016850 (change log)
Symbol HGNC:MIR4489
DescriptionHomo sapiens miR-4489 stem-loop
Stem-loop 
   g    ug   c   ugau       ---g  - g 
5'  gggg  ggg uag    gcaggac    cu g g
    ||||  ||| |||    |||||||    || |  
3'  cccu  ccc guc    cguccug    gg c g
   a    gu   a   ----       aaga  u a
Get sequence
Deep sequencing
121 reads, 0 reads per million, 33 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 65649192-65649253 [+]
sense
OTTHUMT00000391042 ; CTSW-001; intron 3
OTTHUMT00000391044 ; CTSW-002; intron 3
OTTHUMT00000391045 ; CTSW-004; intron 3
ENST00000307886 ; CTSW-001; intron 3
ENST00000528419 ; CTSW-002; intron 3
ENST00000526034 ; CTSW-004; intron 3
Database links

Mature sequence hsa-miR-4489

Accession MIMAT0019023
Sequence

6 -  

uggggcuagugaugcaggacg

 - 26

Get sequence
Deep sequencing95 reads, 17 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).