Stem-loop sequence hsa-mir-548al

Accession

MI0016851 (change log)

Symbol

HGNC:MIR548AL

Description

Homo sapiens miR-548al stem-loop

Gene family

MIPF0000317; mir-548

Literature search

56 open access papers mention hsa-mir-548al
(170 sentences)

Stem-loop

   --------   c           a                   aaaa      
5'         ggu ggugcaaaagu auugcuguuuuugccauua    uaaug 
           ||| ||||||||||| |||||||||||||||||||    |||| g
3'         cua ccauguuuuca uaacggcaaaaacgguaau    auuac 
   ucuauaau   a           g                   gaaa      

Deep sequencing

3542 reads, 1.47 reads per million, 136 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr11: 74399237-74399333 [+]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:MIR548AL
• HGNC:MIR548AL
• RNAcentral:URS000075CCD2_9606
• miRBase Tracker:MI0016851

Mature sequence hsa-miR-548al

• Accession: MIMAT0019024
• Sequence: 65 - aacggcaaugacuuuuguacca - 86
• Deep sequencing: 291 reads, 83 experiments
• Evidence: experimental; Illumina [1]
• Database links:
  • RNAcentral:URS00004526F6_9606
• Predicted targets:
  • TargetMiner:hsa-miR-548al
  • TargetScanVert:hsa-miR-548al
  • miRDB:hsa-miR-548al

References

1. PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).