![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-548al |
|||||
Accession | MI0016851 (change log) | ||||
Symbol | HGNC:MIR548AL | ||||
Description | Homo sapiens miR-548al stem-loop | ||||
Gene family | MIPF0000317; mir-548 | ||||
Literature search |
![]()
56 open access papers mention hsa-mir-548al | ||||
Stem-loop |
-------- c a aaaa 5' ggu ggugcaaaagu auugcuguuuuugccauua uaaug ||| ||||||||||| ||||||||||||||||||| |||| g 3' cua ccauguuuuca uaacggcaaaaacgguaau auuac ucuauaau a g gaaa |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-548al |
|
Accession | MIMAT0019024 |
Sequence |
65 - aacggcaaugacuuuuguacca - 86 |
Deep sequencing | 291 reads, 83 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|