![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4503 |
|||||
Accession | MI0016866 (change log) | ||||
Symbol | HGNC:MIR4503 | ||||
Description | Homo sapiens miR-4503 stem-loop | ||||
Stem-loop |
a uuu u aa 5' caauguagauauuuaagcaggaaauagaa aca aua u ||||||||||||||||||||||||||||| ||| ||| 3' guuacaucuauaaauucguccuuuaucuu ugu uau u c --- u cu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-4503 |
|
Accession | MIMAT0019039 |
Sequence |
13 - uuuaagcaggaaauagaauuua - 34 |
Deep sequencing | 15 reads, 10 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|