![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4507 |
||||||||||
Accession | MI0016871 (change log) | |||||||||
Symbol | HGNC:MIR4507 | |||||||||
Description | Homo sapiens miR-4507 stem-loop | |||||||||
Literature search |
1 open access papers mention hsa-mir-4507 | |||||||||
Stem-loop |
u g g g g aa 5' cu ggcu agcc agcu gguu g || |||| |||| |||| |||| 3' gg ucgg ucgg uugg ucga c u g g g g gc |
|||||||||
Deep sequencing |
| |||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||
Genome context |
|
|||||||||
Clustered miRNAs |
|
|||||||||
Database links |
Mature sequence hsa-miR-4507 |
|
Accession | MIMAT0019044 |
Sequence |
32 - cuggguugggcugggcuggg - 51 |
Deep sequencing | 125 reads, 48 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|