Stem-loop sequence hsa-mir-4509-3

AccessionMI0016875 (change log)
Symbol HGNC:MIR4509-3
DescriptionHomo sapiens miR-4509-3 stem-loop
Gene family MIPF0001207; mir-4509
Stem-loop
   c                 c                    cccuuuc 
5'  uuuaauacuaucucaaa uaaaggauauagaagguuuu       u
    ||||||||||||||||| ||||||||||||||||||||        
3'  agauuaugauagaguuu auuuccuaugucuuccaaag       c
   a                 u                    ucccguu 
Get sequence
Deep sequencing
48 reads, 0 reads per million, 24 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr15: 28490752-28490845 [-]
sense
OTTHUMT00000251358 ; HERC2-001; intron 23
ENST00000261609 ; HERC2-001; intron 23
Database links

Mature sequence hsa-miR-4509

Accession MIMAT0019046
Sequence

18 - 

acuaaaggauauagaagguuuu

 - 39

Get sequence
Deep sequencing27 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).