Hsa-mir-4511 is a microRNA that has been observed to increase in expression in certain biological contexts. Specifically, it was among the most increased microRNAs in a study that measured levels of various miRs, indicating its potential biological significance [PMC8199419]. This miRNA was also identified as part of a miRNA-mRNA network related to muscle, suggesting its involvement in muscle-related regulatory processes [PMC8325595]. Moreover, hsa-mir-4511 has been found to target TLR1, which is involved in the innate immune response [PMC9526608]. In the context of lupus nephritis (LN), particularly class IV LN, hsa-mir-4511 expression was increased in the peripheral blood of patients [PMC9618628]. Additionally, a genetic variant known as rs34089864 has been shown to disrupt binding sites for hsa-mir-4511 and create new binding sites for other miRNAs [PMC5842303]. This alteration could potentially affect gene regulation and contribute to disease pathology. Lastly, hsa-mir-4511 is among several novel differentially abundant miRNAs identified in the plasma of patients with class IV lupus nephritis and could serve as a candidate for diagnostic biomarker development [PMC5685598].
a ca uc aaaaaaagggaaaGAAGAACUGUUGCAUUUGCCCUg c a |||||||||||||||||||||||||||||||||||| | g uuuuuuucccuuucuucuugauaacguaaaugggac g u a ac uu
| Accession | MIMAT0019048 | 
| Description | Homo sapiens hsa-miR-4511 mature miRNA | 
| Sequence | 15 - GAAGAACUGUUGCAUUUGCCCU - 36 | 
| Evidence | experimental Illumina [1-2], qPCR [2] | 
| Database links |       | 
| Predicted targets |       | 
| 
 |