![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4513 |
|||||
Accession | MI0016879 (change log) | ||||
Symbol | HGNC:MIR4513 | ||||
Description | Homo sapiens miR-4513 stem-loop | ||||
Literature search |
4 open access papers mention hsa-mir-4513 | ||||
Stem-loop |
a - - cgg a cau c gu 5' uucu agguggggagacu ga cugg ggcc aag u c |||| ||||||||||||| || |||| |||| ||| | 3' aaga uucaccccucugg cu gacc ccgg uuc a u c c u uua c --c a aa |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-4513 |
|
Accession | MIMAT0019050 |
Sequence |
14 - agacugacggcuggaggcccau - 35 |
Deep sequencing | 22 reads, 9 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|