![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-1269b |
|||||
Accession | MI0016888 (change log) | ||||
Symbol | HGNC:MIR1269B | ||||
Description | Homo sapiens miR-1269b stem-loop | ||||
Literature search |
![]()
6 open access papers mention hsa-mir-1269b | ||||
Stem-loop |
u uu ug c gcua gcuucu u 5' gaggu c ga ugagccau cug cugg u ||||| | || |||||||| ||| |||| 3' cucca g cu auucggua gac gacc c u gg ua - ---- --auuc u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-1269b |
|
Accession | MIMAT0019059 |
Sequence |
9 - cuggacugagccaugcuacugg - 30 |
Deep sequencing | 18539 reads, 76 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|