Stem-loop sequence hsa-mir-1269b

AccessionMI0016888 (change log)
Symbol HGNC:MIR1269B
DescriptionHomo sapiens miR-1269b stem-loop
Literature search

6 open access papers mention hsa-mir-1269b
(87 sentences)

Stem-loop 
   u     uu ug  c        gcua   gcuucu    u 
5'  gaggu  c  ga ugagccau    cug      cugg u
    |||||  |  || ||||||||    |||      ||||  
3'  cucca  g  cu auucggua    gac      gacc c
   u     gg ua  -        ----   --auuc    u
Get sequence
Deep sequencing
18568 reads, 77.4 reads per million, 84 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 12917268-12917342 [-]
sense
OTTHUMT00000129936 ; ELAC2-003; intron 4
OTTHUMT00000441675 ; ELAC2-015; intron 4
OTTHUMT00000129934 ; ELAC2-001; intron 5
OTTHUMT00000129935 ; ELAC2-002; intron 5
OTTHUMT00000441600 ; ELAC2-012; intron 5
OTTHUMT00000472075 ; ELAC2-023; intron 5
OTTHUMT00000471607 ; ELAC2-021; intron 5
OTTHUMT00000441672 ; ELAC2-020; intron 5
OTTHUMT00000441673 ; ELAC2-017; intron 5
OTTHUMT00000471608 ; ELAC2-022; intron 5
OTTHUMT00000441674 ; ELAC2-016; intron 5
ENST00000484122 ; ELAC2-003; intron 4
ENST00000578071 ; ELAC2-015; intron 4
ENST00000338034 ; ELAC2-001; intron 5
ENST00000395962 ; ELAC2-002; intron 5
ENST00000426905 ; ELAC2-012; intron 5
ENST00000609345 ; ELAC2-023; intron 5
ENST00000609101 ; ELAC2-021; intron 5
ENST00000580504 ; ELAC2-020; intron 5
ENST00000581499 ; ELAC2-017; intron 5
ENST00000609757 ; ELAC2-022; intron 5
ENST00000583371 ; ELAC2-016; intron 5
Database links

Mature sequence hsa-miR-1269b

Accession MIMAT0019059
Sequence

9 -  

cuggacugagccaugcuacugg

 - 30

Get sequence
Deep sequencing18539 reads, 76 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).