![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4522 |
|||||
Accession | MI0016889 (change log) | ||||
Symbol | HGNC:MIR4522 | ||||
Description | Homo sapiens miR-4522 stem-loop | ||||
Literature search |
2 open access papers mention hsa-mir-4522 | ||||
Stem-loop |
--- c ug uggg c g -------au c 5' g gggcgu cc ggccu gcagg ggag ccagc c | |||||| || ||||| ||||| |||| ||||| 3' c ucugcg gg ccgga ugucc ucuc ggucg a ggu u gu ---- - g agucgccuu g |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-4522 |
|
Accession | MIMAT0019060 |
Sequence |
55 - ugacucugccuguaggccggu - 75 |
Deep sequencing | 49 reads, 37 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|