Stem-loop sequence hsa-mir-4524a

Accession

MI0016891 (change log)

Previous IDs

hsa-mir-4524

Symbol

HGNC:MIR4524A

Description

Homo sapiens miR-4524a stem-loop

Gene family

MIPF0001330; mir-4524

Literature search

1 open access papers mention hsa-mir-4524a
(1 sentences)

Stem-loop

   -   c             a         cugcag 
5'  gaa gauagcagcauga ccugucuca      a
    ||| ||||||||||||| |||||||||       
3'  cuu cuaucgucguauu ggacagagu      a
   a   c             c         uuuauu 

Deep sequencing

663 reads, 0 reads per million, 90 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr17: 69099564-69099632 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000431480 ; RP11-879D6.1-001; intron 3

  ENST00000569074 ; CASC17-001; intron 3

Clustered miRNAs

< 10kb from hsa-mir-4524a

• hsa-mir-4524a: chr17: 69099564-69099632 [-]
• hsa-mir-4524b: chr17: 69099542-69099656 [+]

Database links

• EntrezGene:MIR4524
• HGNC:MIR4524A
• RNAcentral:URS000075EBFC_9606
• miRBase Tracker:MI0016891

Mature sequence hsa-miR-4524a-5p

• Accession: MIMAT0019062
• Previous IDs: hsa-miR-4524
• Sequence: 6 - auagcagcaugaaccugucuca - 27
• Deep sequencing: 196 reads, 51 experiments
• Evidence: experimental; Illumina [1-2,4]
• Database links:
  • RNAcentral:URS000075C58E_9606
• Predicted targets:
  • TargetMiner:hsa-miR-4524a-5p
  • TargetScanVert:hsa-miR-4524a-5p
  • miRDB:hsa-miR-4524a-5p

Mature sequence hsa-miR-4524a-3p

• Accession: MIMAT0019063
• Previous IDs: hsa-miR-4524*
• Sequence: 42 - ugagacaggcuuaugcugcuau - 63
• Deep sequencing: 461 reads, 76 experiments
• Evidence: experimental; Illumina [1-2,4]
• Database links:
  • RNAcentral:URS0000475586_9606
• Predicted targets:
  • TargetMiner:hsa-miR-4524a-3p
  • TargetScanVert:hsa-miR-4524a-3p
  • miRDB:hsa-miR-4524a-3p

References

1. PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).
2. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
3. PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).
4. PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).