![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4525 |
|||||
Accession | MI0016892 (change log) | ||||
Symbol | HGNC:MIR4525 | ||||
Description | Homo sapiens miR-4525 stem-loop | ||||
Stem-loop |
g a - u --g ug 5' ucag gg gggga gugcaugcugguugg g ggc |||| || ||||| ||||||||||||||| | || u 3' aguc cc ccccu cacgugcgacuaacc u ccg a - a u agg gu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-4525 |
|
Accession | MIMAT0019064 |
Sequence |
7 - ggggggaugugcaugcugguu - 27 |
Deep sequencing | 208 reads, 41 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|